1. Purify the genome

Exploring coverage and GC%

  • From the sequencing company, got the assembly consisting of 174 contigs with 76,648,537bp and 93.9% compeleteness (BUSCO on chlorophyta_odb10). However, the company also reported assemblies made with less data and of only slightly lower quality on 26 contigs. Could it be that the bigger assembly contains contaminants?
  • Will do binning to identify contigs that might be external
  • First, use minimap to align the reads onto the assembly
mkdir analysis_and_temp_files/02_genome_annotation

source package c92263ec-95e5-43eb-a527-8f1496d56f1a 
source package 222eac79-310f-4d4b-8e1c-0cece4150333

minimap2 -t 20 -a data/your-data_fg25005_2025-03-20_1225/FG25005_01_GTX0536.fasta data/your-data_fg25005_2025-03-20_1225/FG25005_05_PAO94355_20250305_dorado_7.4.13_sup_pass.fastq.gz | samtools sort -@8 -o analysis_and_temp_files/04_genome_annotation/GTX0536.bam

samtools index analysis_and_temp_files/04_genome_annotation/GTX0536.bam
samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta
  • Use metaBAT, which produced 23 bins
source package 0a2dffce-c151-4379-abe9-866414c91cd7
cp data/your-data_fg25005_2025-03-20_1225/FG25005_01_GTX0536.fasta analysis_and_temp_files/04_genome_annotation/GTX0536.fasta

runMetaBat.sh -t 20 analysis_and_temp_files/04_genome_annotation/GTX0536.fasta analysis_and_temp_files/04_genome_annotation/GTX0536.bam

mv  GTX0536.fasta.* analysis_and_temp_files/04_genome_annotation
  • Identify prokaryotic MAGs with CheckM (plus calculate coverage depth for each contig and gc%). No plausible bacterial genomes here
source package  5a1c6a9a-f666-4eaa-9409-3e7435d86406
checkm coverage analysis_and_temp_files/04_genome_annotation/GTX0536.fasta.metabat* analysis_and_temp_files/04_genome_annotation/GTX0536.cov analysis_and_temp_files/04_genome_annotation/GTX0536.bam -x fa

sbatch --mem=100G -c 20 --wrap="source package  5a1c6a9a-f666-4eaa-9409-3e7435d86406; checkm  lineage_wf analysis_and_temp_files/04_genome_annotation/GTX0536.fasta.metabat* analysis_and_temp_files/04_genome_annotation/GTX0536_checkm -x fa --tab_table > analysis_and_temp_files/04_genome_annotation/GTX0536.checkm"

source package /tsl/software/testing/bin/bbmap-37.90 
stats.sh in=analysis_and_temp_files/04_genome_annotation/GTX0536.fasta gc=analysis_and_temp_files/04_genome_annotation/GTX0536.gc gcformat=4
  • Visualize binning result. One contig (ptg000005c) had a super high coverage at 2246x, which is probably an organelle genome. The rest are split into two groups at ~36% GC and 50%
gc<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536.gc",header=T)
colnames(gc)[1]<-"contig"
gc$GC<-as.numeric(gc$GC)
cov<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536.fasta.depth.txt")
colnames(cov)[1]<-"contig"
bins<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536.cov")
colnames(bins)[1]<-"contig"

df<-left_join(gc,cov) %>% left_join(bins)
## Joining with `by = join_by(contig)`
## Joining with `by = join_by(contig)`
df$totalAvgDepth <- as.numeric(df$totalAvgDepth )

ggplot(df)+geom_point(aes(x=GC,y=totalAvgDepth,color=Bin.Id))

  • Let’s remove ptg000005c:
    • This highlighted another contig ptg000019l at 390x: could be another organelle genome, but is >2Mbp. Maybe a part of the nuclear genome?
    • The group at 50% GC and 200x has longest contigs. Most likely, these correspond to the nuclear genome
library(patchwork)
g1<-ggplot(df %>% filter(contig!="ptg000005c"))+geom_point(aes(x=GC,y=totalAvgDepth,color=Bin.Id))
g2 <- ggplot(df %>% filter(contig!="ptg000005c"))+geom_point(aes(x=GC,y=totalAvgDepth,color=Length))
g1/g2

  • Lets look closer at this region. It contained 22 contigs, most from bins 9 and 7. bins 2, 14, and 22 (just one contig each) are also very clearly in the same cloud. bins 13 and 18 (again just one contig each; coverage in the range 190-200) are probably also the part of the genome with the length of >2Mbp. Bin 18 (coverage 181x) is slightly below 1Mbp. The lowest three contigs in coverage are also the shortest (58 kbp to 190 kbp)
g1<-ggplot(df %>% filter(GC >0.45,totalAvgDepth > 150, totalAvgDepth <300))+ geom_point(aes(x=GC,y=totalAvgDepth,color=Bin.Id))
g2 <- ggplot(df %>% filter(GC >0.45,totalAvgDepth > 150, totalAvgDepth <300))+ geom_point(aes(x=GC,y=totalAvgDepth,color=Length))
g1+g2

Blasting against NCBI

  • Look at ten matches per contig
source package /tsl/software/testing/bin/blast+-2.9.0  
blastn \
 -query analysis_and_temp_files/04_genome_annotation/GTX0536.fasta \
 -db /tsl/data/ncbi_database/blast/nt_20220819/nt \
 -outfmt '6 qseqid staxids bitscore std' \
 -max_target_seqs 10 \
 -max_hsps 1 \
 -evalue 1e-25 \
 -out analysis_and_temp_files/04_genome_annotation/GTX0536.blast.out -num_threads 20
  • Go taxonomy for each hit, and identified the hits that are labelled as mitochondrial
library(taxize)

#get taxid for each hit based on its accession ID
blast_results<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536.blast.out",header=F)

get_taxid <- function(x){
  list <- genbank2uid(id = x, key="86df5e42e9751ae03c5e114326c1740ef008")
  list2 <- lapply(list,attributes)
df <- data.frame("accession"=x,
                 "taxid"=list[[1]][1],
      "description"=list2[[1]]$name)
return(df)}

l<-lapply(blast_results$V5,get_taxid)
acc_taxid <- do.call(rbind,l)
acc_taxid <- acc_taxid %>% filter(!is.na(taxid),taxid!="") %>% distinct()

#get taxonomy for each taxid
get_taxonomy<- function(x){
  df <- classification(x,db="ncbi",key="86df5e42e9751ae03c5e114326c1740ef008")[[1]]
  df <- df %>% filter(rank %in% c("domain","kingdom","phylum","class")) %>% select(-id) %>% mutate(taxid=x)
  return(df)}

l2<-lapply(unique(acc_taxid$taxid) ,get_taxonomy)
taxonomy <- do.call(rbind,l2) %>% pivot_wider(names_from = rank,values_from=name)

#combine all data together
blast <- blast_results %>% select(V1,V5)
colnames(blast) <- c("contig","accession")
blast2 <- acc_taxid %>% left_join(taxonomy) %>% left_join(blast)  %>% distinct()

#save the table so that I don't need to re-run the ncbi step
write.table(blast2, "../analysis_and_temp_files/02_genome_annotation/GTX0536.blast.taxonomy.txt",col.names = T, row.names = F, quote = F,sep="\t")
  • This confirms that the sequences in the cluster with bin 7 and bin 9 are the nuclear genome
    • Plastid genome is ptg000005c
    • ptg000019l also has plastid hits, which is weird given that it’s linear and >2Mbp, will keep an eye on that
    • Mitochondrial genome is the cluster at 35 GC%, and it clearly failed to assemble, which is common. Will re-assemble it later on with a specialized software
library(gridExtra)
## 
## Attaching package: 'gridExtra'
## The following object is masked from 'package:dplyr':
## 
##     combine
library(ggforce)

blast<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536.blast.taxonomy.txt",header=T)

blast<- blast %>% mutate(label=case_when(
  is.na(domain) ~ "Virus",
  phylum=="Chlorophyta" & grepl("mitochon",description,) ~ "Chlorophyta mitochondrial",
  phylum=="Chlorophyta" & grepl("chloroplast",description) ~ "Chlorophyta plastid",
  phylum=="Chlorophyta" & ! grepl("chloroplast",description) & !grepl("mitochon",description) ~ "Chlorophyta nuclear",
  phylum %in% c("Streptophyta","Rhodophyta") ~ "other Archaeplastida",
  phylum %in% c("Annelida" ,"Arthropoda","Chordata","Nematoda","Bryozoa")~ "Animals"
))

blast_summary<-blast %>% filter(!is.na(label)) %>%
  group_by(label,contig) %>% summarize(n=n()) %>%
  ungroup() %>% group_by(contig) %>% top_n(n=1)
## `summarise()` has grouped output by 'label'. You can override using the
## `.groups` argument.
## Selecting by n
df<- blast_summary %>% left_join(df)
## Joining with `by = join_by(contig)`
ggplot(df)+geom_point(aes(x=GC,y=totalAvgDepth,color=label))+
  facet_zoom(ylim = c(0, 400))

ggsave("../results/gc_cov.pdf",width=9,height=4)

Align to the genome from ASG

source package 222eac79-310f-4d4b-8e1c-0cece4150333
minimap2 -x asm20 -t 10 --secondary=no data/SL0000003.fasta analysis_and_temp_files/04_genome_annotation/GTX0536.fasta > analysis_and_temp_files/04_genome_annotation/GTX0536_SL0000003.paf
  • Alignment overall looks reasonable (here showing only stretches >20kbp with quality >40)
library(pafr)
paf<-read_paf("../analysis_and_temp_files/02_genome_annotation/GTX0536_SL0000003.paf")
paf_filtered <-subset(paf, alen > 20000 & mapq > 40)
paf_filtered <-paf_filtered  %>% distinct()
align<-paf_filtered %>% group_by(qname,tname) %>% summarize(total_alen = sum(alen)) %>% 
  pivot_wider(names_from = tname,values_from = total_alen,values_fill=0)
## `summarise()` has grouped output by 'qname'. You can override using the
## `.groups` argument.
dotplot(paf_filtered,order_by="qstart",label_seqs=F,dashes=F) + theme_bw()

  • Checking which contigs mapped to which in the two assembly, see clear ‘partner’ in almost all cases.
    • Exception 1: ptg000002l has about the same total length of matches with OZ234913.1 and OZ234917.1
    • Exception 2: ptg000023l and ptg000065l are partnerless
align<-paf_filtered %>% group_by(qname,tname) %>% summarize(total_alen = sum(alen)) %>% 
  pivot_wider(names_from = tname,values_from = total_alen,values_fill=0)
## `summarise()` has grouped output by 'qname'. You can override using the
## `.groups` argument.
align %>% kable(format = "html", col.names = colnames(align)) %>%
  kable_styling() %>%
  kableExtra::scroll_box(width = "100%", height = "400px")
qname OZ234907.1 OZ234912.1 OZ234914.1 OZ234913.1 OZ234916.1 OZ234917.1 OZ234918.1 OZ234910.1 OZ234919.1 OZ234923.1 OZ234921.1 OZ234924.1 OZ234920.1 OZ234922.1 OZ234909.1 OZ234908.1 OZ234925.1 OZ234906.1 OZ234915.1 OZ234911.1
ptg000001l 168424 51747 10054922 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000002l 0 0 0 12861796 122964 17901346 279330 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000003l 0 12682960 431478 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000004l 40818 0 450840 0 0 0 0 129294 13413450 69279 0 0 0 0 0 0 0 0 0 0
ptg000006l 0 0 0 0 0 0 0 0 0 0 15188720 0 0 0 0 0 0 0 0 0
ptg000007l 0 0 0 0 0 0 0 1129727 0 0 0 5368634 0 0 0 0 0 0 0 0
ptg000008l 0 0 0 0 0 0 0 0 0 0 0 0 4676922 155382 0 0 0 0 0 0
ptg000009l 0 0 0 0 0 0 0 806364 0 0 0 0 0 0 20091160 0 0 0 0 0
ptg000010l 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18421717 0 0 0 0
ptg000011l 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9330528 0 0 0
ptg000012l 634403 0 318467 139290 0 0 0 0 0 0 0 0 0 0 0 0 0 26933188 0 0
ptg000013l 0 0 0 0 0 0 0 1383312 0 0 0 326885 0 0 0 0 0 0 17659341 0
ptg000014l 0 0 376640 0 12250144 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000015l 0 0 0 0 0 0 0 11397846 0 0 0 665886 0 0 0 0 0 0 0 0
ptg000016l 25499502 540889 0 0 0 0 0 0 276272 0 0 0 0 0 0 0 0 0 0 0
ptg000017l 0 0 0 0 0 0 0 139272 0 0 0 0 0 0 0 0 0 0 0 17326658
ptg000018l 0 0 130098 0 0 0 14381475 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000019l 0 0 472765 0 0 0 0 0 0 10603302 0 0 0 0 0 0 0 0 0 0
ptg000020l 0 0 0 0 0 0 0 0 0 0 0 123438 0 8525180 0 0 0 0 0 0
ptg000023l 0 455544 164936 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ptg000065l 0 0 0 0 0 0 0 0 0 0 117952 0 0 0 0 0 0 0 0 0
  • Let’s picture syntheny for all partners
ptg000001l<-plot_synteny(paf_filtered, q_chrom="ptg000001l", t_chrom="OZ234914.1", centre=F)
ptg000002l<-plot_synteny(paf_filtered, q_chrom="ptg000002l", t_chrom="OZ234913.1", centre=F)
ptg000002l_2<-plot_synteny(paf_filtered, q_chrom="ptg000002l", t_chrom="OZ234917.1", centre=F)
ptg000003l<-plot_synteny(paf_filtered, q_chrom="ptg000003l", t_chrom="OZ234912.1", centre=F)
ptg000004l<-plot_synteny(paf_filtered, q_chrom="ptg000004l", t_chrom="OZ234919.1", centre=F)
ptg000006l<-plot_synteny(paf_filtered, q_chrom="ptg000006l", t_chrom="OZ234921.1", centre=F)
ptg000007l<-plot_synteny(paf_filtered, q_chrom="ptg000007l", t_chrom="OZ234924.1", centre=F)
ptg000008l<-plot_synteny(paf_filtered, q_chrom="ptg000008l", t_chrom="OZ234920.1", centre=F)
ptg000009l<-plot_synteny(paf_filtered, q_chrom="ptg000009l", t_chrom="OZ234909.1", centre=F)
ptg000010l<-plot_synteny(paf_filtered, q_chrom="ptg000010l", t_chrom="OZ234908.1", centre=F)
ptg000011l<-plot_synteny(paf_filtered, q_chrom="ptg000011l", t_chrom="OZ234925.1", centre=F)
ptg000012l<-plot_synteny(paf_filtered, q_chrom="ptg000012l", t_chrom="OZ234906.1", centre=F)
ptg000013l<-plot_synteny(paf_filtered, q_chrom="ptg000013l", t_chrom="OZ234915.1", centre=F)
ptg000014l<-plot_synteny(paf_filtered, q_chrom="ptg000014l", t_chrom="OZ234916.1", centre=F)
ptg000015l<-plot_synteny(paf_filtered, q_chrom="ptg000015l", t_chrom="OZ234910.1", centre=F)
ptg000016l<-plot_synteny(paf_filtered, q_chrom="ptg000016l", t_chrom="OZ234907.1", centre=F)
ptg000017l<-plot_synteny(paf_filtered, q_chrom="ptg000017l", t_chrom="OZ234911.1", centre=F)
ptg000018l<-plot_synteny(paf_filtered, q_chrom="ptg000018l", t_chrom="OZ234918.1", centre=F)
ptg000019l<-plot_synteny(paf_filtered, q_chrom="ptg000019l", t_chrom="OZ234923.1", centre=F)
ptg000020l<-plot_synteny(paf_filtered, q_chrom="ptg000020l", t_chrom="OZ234922.1", centre=F)
ptg000001l/(ptg000002l+ptg000002l_2)/ptg000003l/ptg000004l/ptg000006l/ptg000007l/ptg000008l/ptg000009l/ptg000010l/ptg000011l/ptg000012l/ptg000013l/ptg000014l/ptg000015l/ptg000016l/ptg000017l/ptg000018l/ptg000019l/ptg000020l

  • The remaining two pairings do not seem legit
ptg0000023l<-plot_synteny(paf_filtered, q_chrom="ptg000023l", t_chrom="OZ234912.1", centre=TRUE)
ptg0000065l<-plot_synteny(paf, q_chrom="ptg000065l", t_chrom="OZ234921.1", centre=TRUE)
ptg0000023l/ptg0000065l

  • Will nonetheless include contig 23
  • Saved the 20 contigs as analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta
write.table(align$qname[1:19], "../analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.txt",col.names = F, row.names = F, quote = F,sep="\t")
source package 1041444f-cd25-4107-a5c7-5e86cb1728fe
seqkit grep -i -f analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.txt analysis_and_temp_files/02_genome_annotation/GTX0536.fasta  > analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta 

Spotted a problem while visualizing GC% and telomeres

  • Used script from Markus Hiltunen
  • As a query used “CCCTAAA”, which is a telomeric repeat conserved between green algae and land plants (see Fulnekova et al. 2012)
    • 12 contigs have telomeres on both ends
    • 5 have on one end
    • 2 had none
python code/detect_telomers.py analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta -m "CCCTAAA" > analysis_and_temp_files/02_genome_annotation/GTX0536_telomere_detection.txt
  • Used SEQtk and got GC% for non-overlapping windows of 1000 bp
source package 46a62eca-4f8f-45aa-8cc2-d4efc99dd9c6
seqkit sliding  analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta -s 1000 -W 1000  | seqkit fx2tab -n -g > analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta_GC_sliding.txt
  • Everything looks fine, except for the low GC% portion of ptg000019l. That’s the same part of the contig that had hits to plastid genomes, and the same that wasn’t aligned to a contig in the ASG genome. Could this be an misassembly?
library(stringr)
library(viridis)
## Loading required package: viridisLite
gc<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta_GC_sliding.txt",header=F)[,c(1,2)]
colnames(gc)<-c("window","gc_content")
##get contig name and start of the window
gc$contig<-sub("_sliding.*", "", gc$window)  
gc$window<-sub(".*:", "", gc$window)
gc$window_start<-sub("-.*", "", gc$window) %>% as.numeric()
gc$gc_content<-gc$gc_content %>% as.numeric()

##add data for telomere annotation
tel<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_telomere_detection.txt",header=F)[,c(1,2)]
colnames(tel)<-c("contig","position")
tel_start_contig_list<-tel[tel$position=="forward",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')
tel_end_contig_list<-tel[tel$position=="reverse",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')

## get 
tel_start<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% filter(row_number()<25 & contig %in% tel_start_contig_list) %>% mutate(telomere="present") %>% ungroup()

tel_end<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% 
  slice(tail(row_number(), 25)) %>% filter(contig %in% tel_end_contig_list) %>% mutate(telomere="present") %>% ungroup()

gc<-gc %>% left_join(rbind(tel_start,tel_end))
## Joining with `by = join_by(contig, window_start)`
gc$telomere[is.na(gc$telomere)]<-"absent"

##visualize
ggplot(gc)+
  geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,color=gc_content))+
  geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,alpha=telomere),fill="red")+
  xlab("")+ylab("")+
   scale_alpha_discrete(range=c(0,1))+
  scale_color_viridis(begin = 1,end = 0)+
   scale_x_continuous(breaks = c(0,1000000,2000000,3000000,4000000),
                     labels = c("0","1 Mbp","2 Mbp","3 Mbp","4 Mbp"))+
  theme_minimal()
## Warning: Using alpha for a discrete variable is not advised.

Examine read alignment to detected and fix misassemblies

  • Looked at the bam file around the ptg000019l:2410001-2420000 window, where the shift from ~50% GC to ~35% happens
    • Found a clean break at 2,410,725 bp. Clearly, the end portion of the contig comes from the cloroplast, which also explains why the average coverage of this contig was higher than the rest of the nuclear genome. Will remove the chloroplast mathcing portion
knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000019l.png")

  • We can exclude that the same problem happened to other contigs, since they have very similar coverage to each other (192-210x), none had hits to chloroplast ,and none had more than one hit to mitochondrion
  • While we are at it, let’s look at ptg000002l:2972181-3246738, which is the border of the parts of the contig aligned to OZ234917.1 and OZ234913.1. Could this also be a misassembly?
  • To simplify searching, let’s calculate the depth in non-overlapping 1000bp windows for a larger region 2,750,000-3,500,000
for i in {2750..3500}; do s=$(($i*1000)); e=$(($i*1000+1000)); samtools coverage -r ptg000002l:$s-$e analysis_and_temp_files/02_genome_annotation/GTX0536.bam; done > analysis_and_temp_files/02_genome_annotation/ptg000002l.cov
grep "ptg000002l" analysis_and_temp_files/02_genome_annotation/ptg000002l.cov > analysis_and_temp_files/02_genome_annotation/ptg000002l.filtered.cov
  • Coverage is uneven here, but there are no clear changes in GC%. The window with the lowest coverage still shows to ha
depth<-read.delim2("../analysis_and_temp_files/02_genome_annotation/ptg000002l.filtered.cov",header=F)[,c(2,7)]
colnames(depth)<-c("window","depth")
depth$depth <- as.numeric(depth$depth)
gc$window<-as.numeric(gc$window_start-1)

x<-gc %>% filter(contig=="ptg000002l",window>=2750000,window<=3500000) %>% left_join(depth) %>%
  select(window,gc_content,depth) %>% 
  pivot_longer(-window,names_to = "statistic",values_to = "n") %>%
  filter(!is.na(n))
## Joining with `by = join_by(window)`
ggplot(x,aes(x=window,y=n))+ geom_col()+
  facet_wrap(~statistic,scales = "free_y",ncol=1)

  • Looked in IGV at the portion with the most drastic coverage jump (417x in the window 3,024,000 to 100x in 3,025,000), but it still has reasonable coverage and no obvious breaks, as well as the flanking regions
knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000002.png")

  • Can we find telomeres in this region?
    • Nope! got a few hits, but those are not clustered and are likely by chance
samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta ptg000002l:2750000-3500000 > analysis_and_temp_files/02_genome_annotation/ptg000002l_suspect.fa

grep "CCCTAAACCCTAAA" -n analysis_and_temp_files/02_genome_annotation/ptg000002l_suspect.fa
grep "GGGTTTAGGGTTT" -n analysis_and_temp_files/02_genome_annotation/ptg000002l_suspect.fa
  • Can we find telomeric repeats in the middle of other contigs? Searched the entire assembly
seqkit locate -i -p "CCCTAAACCCTAAACCCTAAACCCTAAACCCTAAA" analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear.fasta >  analysis_and_temp_files/02_genome_annotation/GTX0536_telomeric_repeats_across.txt
  • Got one short match in the middle of ptg000002l
    • Back-to-back reverse and forward repeats in the middle of ptg000003l
    • one area in ptg000004l, ptg000008l, and ptg000009l; all reverse
    • Several areas, both forward and reverse in ptg000019l
library(ivs)

repeats<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_telomeric_repeats_across.txt",header=T)
colnames(repeats)[1]<-"contig"
repeats<- repeats %>% left_join(df %>% select(contig,Length))
## Joining with `by = join_by(contig)`
#remove hits that are closer than 1,500 bp tp a contig end
repeats2 <- repeats %>% mutate(Length_2000 = Length-2000) %>%
  filter((strand=="+" & start>2000) | (strand=="-" & end<Length_2000))

repeats3 <- repeats2 %>%
  group_by(contig,strand) %>%
  mutate(group = iv_identify_group(iv(start, end))) %>%
  group_by(group, .add = TRUE) %>%
  summarise(start = min(iv_start(group)),
             end = max(iv_end(group))) %>%
  select(contig,strand,start,end)
## `summarise()` has grouped output by 'contig', 'strand'. You can override using
## the `.groups` argument.
repeats3%>% kable(format = "html", col.names = colnames(repeats3)) %>%
  kable_styling() %>%
  kableExtra::scroll_box(width = "100%", height = "300px")
contig strand start end
ptg000002l
2984188 2984222
ptg000003l
3706286 3706481
ptg000003l
3706488 3706613
ptg000003l
3705509 3705634
ptg000003l
3705641 3706235
ptg000004l
3026801 3026877
ptg000004l
3026911 3027428
ptg000008l
1708678 1708726
ptg000009l
3382353 3382401
ptg000009l
3976044 3976085
ptg000019l
8679 8734
ptg000019l
12336 12391
ptg000019l
15661 15695
ptg000019l
2409990 2410066
ptg000019l
2410104 2410145
ptg000019l
2410152 2410718
  • Identified several irregularity, where at the end of a contig there is a break. To remedy this, will remove the ‘tails’. From ptg000003l remove bases after 3706235
  • knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000003l_3704286-3708286.png")

    • From ptg000004l remove bases after 3027428
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000004l_3026090-3030090.png")

    • All other matches to telomeric repeats were not associated with assembly breaks analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/
    • To be safe, examined other end of contigs that lack telomeres to exclude similar problems. Found that beginning of contig 8 suffers from the same problem. Will remove first 1035 bp
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000008l_1-4000.png")

    • Will remove bases past 4,931,045 from ptg000016l
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000016l_4929045-4931045.png")

    • Will remove bases past 2,339,172 ptg000020l and before 1071
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000020l_1-4000.png")

    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/checking_for_misassemblies/ptg000020l_2335936-2339936.png")

    Scafolding of the ‘tail’ of ptg000003l? Didn’t work

    • Unlike other ‘tails’ which short, the tail of ptg000003l is (3706236 to 3719598) is 13362 bp, and it also seem to contain a forward telomeric repeat. Could it be a fragment of a different contig?
      • Looking at the existing paf file, this region only got hit to middle of two different contigs, each <1500bp
    subset(paf, qname=="ptg000003l" & qend>3706236 & mapq > 40) %>%
      select(qname,qstart,qend,tname,tstart,tend) %>% distinct()
    ## pafr object with 2 alignments (0Mb)
    ##  1 query seqs
    ##  2 target seqs
    ##  -6 tags:
    • Aligning just the tail against the SL0000003 genome, didn’t get any hits with better quality
    • Aligning it against the GTX0536 assembly from which the tail is removed, it maps back on to the same contig but in reverse strand
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000003l:3706236-3719598 > analysis_and_temp_files/02_genome_annotation/ptg000003l_tail.fa 
    blastn -query analysis_and_temp_files/02_genome_annotation/ptg000003l_tail.fa  -subject data/SL0000003.fasta -outfmt 6
    
    minimap2 -x asm20 -t 10 --secondary=no data/SL0000003.fasta analysis_and_temp_files/02_genome_annotation/ptg000003l_tail.fa > analysis_and_temp_files/02_genome_annotation/ptg000003l_tail_SL0000003.paf
    
    ptg000003l:3706236-3719598      13363   4020    5359    -       OZ234919.1      2842224 730997  732352  615     1378    60      tp:A:P  cm:i:69 s1:i:597      s2:i:280        dv:f:0.0078     rl:i:414
    ptg000003l:3706236-3719598      13363   1660    2765    -       OZ234917.1      2908467 564827  565829  283     1127    60      tp:A:P  cm:i:18 s1:i:252      s2:i:0  dv:f:0.0081     rl:i:414
    ptg000003l:3706236-3719598      13363   3349    3833    -       OZ234916.1      3059195 732081  732606  106     525     17      tp:A:P  cm:i:8  s1:i:98       s2:i:85 dv:f:0.0166     rl:i:414
    ptg000003l:3706236-3719598      13363   672     1119    +       OZ234913.1      3320455 426382  426832  57      453     0       tp:A:P  cm:i:3  s1:i:54       s2:i:46 dv:f:0.0503     rl:i:414
    ptg000003l:3706236-3719598      13363   570     858     +       OZ234922.1      2422596 249762  250050  46      288     5       tp:A:P  cm:i:3  s1:i:46       s2:i:0  dv:f:0.0562     rl:i:414
    
    
    minimap2 -x asm20 -t 10 analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta analysis_and_temp_files/02_genome_annotation/ptg000003l_tail.fa
    
    ptg000003l:3706236-3719598      13363   233     13353   -       ptg000003l:1-3706235    3706235 3692266 3705653 7673    13430   60      tp:A:P  cm:i:1169     s1:i:7578       s2:i:290        dv:f:0.0002     rl:i:945

    Finalized the genome

    • Made a new fasta file where portion of contigs outlined above are truncated
    seqkit grep -i -f analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.txt analysis_and_temp_files/02_genome_annotation/GTX0536.fasta  > analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000019l:1-2410725 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000003l:1-3706235 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000004l:1-3027428 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000008l:1035-2212220 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000016l:1-4931045 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000020l:1071-2339172 >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta 
    • At a later stage, added another contig (ptg000023l), after it became clear that it contained GEX1 gene that wasn’t found elsewhere in the genome, but was present in all other Trebouxia genomes (minus SL0003 genome)
    cp analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2.fasta 
    
    source package aeee87c4-1923-4732-aca2-f2aff23580cc
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000023l >> analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2.fasta 
    • Cleaned and sorted the assembly using funannotate
    singularity run ../singularity/funannotate.sif funannotate sort -i analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2.fasta -o analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta -b GTX0536

    Check completeness scores

    • BUSCO score: C:96.5%[S:95.9%,D:0.6%],F:0.7%,M:2.8%,n:1519
      (BUSCO v4.0.6, chlorophyta_odb10)
    mkdir analysis_and_temp_files/02_genome_annotation/GTX0536_busco2
    source package ca890cd7-f81d-4c22-9f4a-5b40ab671c79
    source package 85f2de80-4bd0-48dc-9303-bba1a19206e4
    export AUGUSTUS_CONFIG_PATH=../02_long_read_assemblies/analysis_and_temp_files/02_binning/tmp_augustus/config
    busco -i analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2.fasta -o GTX0536 --out_path analysis_and_temp_files/02_genome_annotation/GTX0536_busco2  -m  genome -l /tsl/data/busco_lineages/chlorophyta_odb10 --offline -f -c 20
    • For comparison, analyzed the ASG genome, and got slightly worse results
      • C:92.3%[S:91.6%,D:0.7%],F:0.5%,M:7.2%,n:1519
    busco -i data/SL0000003.fasta -o SL0000003 --out_path analysis_and_temp_files/02_genome_annotation/SL0000003_busco  -m  genome -l /tsl/data/busco_lineages/chlorophyta_odb10 --offline -f -c 20
    • Visualize completeness scores
    library(geomtextpath)
    
    busco1<-read.delim("../analysis_and_temp_files/02_genome_annotation/GTX0536_busco/GTX0536/short_summary.specific.chlorophyta_odb10.GTX0536.txt",header=F,skip = 9)
    busco1$type<-c("Complete (95.9%)","Duplicated (0.6%)","Fragmented (0.7%)","Missing (2.8%)","Total")
    busco1<-busco1[1:4,]
    hsize <- 1.5
    busco1$x<-hsize
    
    b1<-ggplot(busco1,aes(y=V2,fill=type,x=hsize))+geom_col()+
      coord_curvedpolar(theta = "y")+  xlim(c(0.2, hsize + 0.5))+
      scale_fill_manual(values=c("Complete (95.3%)"="#60ba30","Duplicated (0.5%)"="#1f5900","Fragmented (0.7%)"="#ccf2b8","Missing (3.5%)"="white"))+
      theme_void()+theme(legend.title = element_blank(),legend.text = element_text(size=9),
                         legend.key=element_rect(colour="#969696"))+
      ggtitle("GTX0536")
    
    busco2<-read.delim("../analysis_and_temp_files/02_genome_annotation/SL0000003_busco/SL0000003/short_summary.specific.chlorophyta_odb10.SL0000003.txt",header=F,skip = 9)
    busco2$type<-c("Complete (91.6%)","Duplicated (0.7%)","Fragmented (0.5%)","Missing (7.2%)","Total")
    busco2<-busco2[1:4,]
    hsize <- 1.5
    busco2$x<-hsize
    
    b2<-ggplot(busco2,aes(y=V2,fill=type,x=hsize))+geom_col()+
      coord_curvedpolar(theta = "y")+  xlim(c(0.2, hsize + 0.5))+
      scale_fill_manual(values=c("Complete (91.6%)"="#60ba30","Duplicated (0.7%)"="#1f5900","Fragmented (0.5%)"="#ccf2b8","Missing (7.2%)"="white"))+
      theme_void()+theme(legend.title = element_blank(),legend.text = element_text(size=9),
                         legend.key=element_rect(colour="#969696"))+
      ggtitle("SL0000003")
    b1+b2

    ggsave("../results/busco.pdf",plot=b1,width=3,height=3)

    Visualizing GC% and telomeres again

    python code/detect_telomers.py analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta -m "CCCTAAA" > analysis_and_temp_files/02_genome_annotation/GTX0536_final_telomere_detection2.txt
    
    seqkit sliding  analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta -s 1000 -W 1000  | seqkit fx2tab -n -g > analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta_GC_sliding2.txt
    • Now, got both telomeres on 16 contigs and singe telomere on the remaining 3
    gc<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final.fasta_GC_sliding2.txt",header=F)[,c(1,4)]
    colnames(gc)<-c("window","gc_content")
    ##get contig name and start of the window
    gc$contig<-sub("_sliding.*", "", gc$window)  
    gc$window<-sub(".*:", "", gc$window)
    gc$window_start<-sub("-.*", "", gc$window) %>% as.numeric()
    gc$gc_content<-gc$gc_content %>% as.numeric()
    
    ##add data for telomere annotation
    tel<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_final_telomere_detection2.txt",header=F)[,c(1,2)]
    colnames(tel)<-c("contig","position")
    tel_start_contig_list<-tel[tel$position=="forward",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')
    tel_end_contig_list<-tel[tel$position=="reverse",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')
    
    ## get 
    tel_start<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% filter(row_number()<50 & contig %in% tel_start_contig_list) %>% mutate(telomere="present") %>% ungroup()
    
    tel_end<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% 
      dplyr::slice(tail(row_number(), 50)) %>% filter(contig %in% tel_end_contig_list) %>% mutate(telomere="present") %>% ungroup()
    
    gc<-gc %>% left_join(rbind(tel_start,tel_end))
    ## Joining with `by = join_by(contig, window_start)`
    gc$telomere[is.na(gc$telomere)]<-"absent"
    
    ##visualize
    ggplot(gc)+
      geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,color=gc_content,height = 0.8))+
      geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,alpha=telomere,height=0.9),fill="red")+
      xlab("")+ylab("")+
       scale_alpha_discrete(range=c(0,1))+
      scale_color_viridis(begin = 1,end = 0)+
       scale_x_continuous(breaks = c(0,2000000,4000000,6000000),
                         labels = c("0","2 Mbp","4 Mbp","6 Mbp"))+
      theme_minimal()
    ## Warning: Using alpha for a discrete variable is not advised.

    ggsave("../results/genome.pdf",width=5,height=4)

    Visualize syntheny between the finalized genome and ASG

    • Re-ran minimap alignment on the finalized genome
    minimap2 -x asm20 -t 10 analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta data/SL0000003.fasta > analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2_SL0000003.paf
    • Get info on contig lengths for both files
    seqkit fx2tab --length --name --header-line  data/SL0000003.fasta > analysis_and_temp_files/02_genome_annotation/SL0000003.lengths.txt
    
    seqkit fx2tab --length --name --header-line  analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta > analysis_and_temp_files/02_genome_annotation/GTX0536.2.lengths.txt
    • Visualize
    library(syntenyPlotteR.BETA)
    #prep inputs
    paf2<-read_paf("../analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final2_SL0000003.paf")
    paf2_filtered <-subset(paf2, alen > 20000 & mapq > 40)
    paf2_filtered <-paf2_filtered  %>% distinct()
    paf2_filtered <- paf2_filtered[,c(6,8,9,1,3,4,5)]
    paf2_filtered$tname <- str_replace(paf2_filtered$tname,"GTX0536_","")
    paf2_filtered$qname <- str_replace(paf2_filtered$qname,"OZ2349","")
    paf2_filtered$qname <- str_replace(paf2_filtered$qname,"\\.1","")
    paf2_filtered$q <- "GTX0536"
    paf2_filtered$t<- "SL0000003"
    
    write.table(paf2_filtered,"../analysis_and_temp_files/02_genome_annotation/synteny_paf.txt",quote = F, col.names = F, row.names = F,sep="\t")
    
    size1 <- read.delim("../analysis_and_temp_files/02_genome_annotation/GTX0536.2.lengths.txt")[,c(1,4)] %>% mutate(id="GTX0536")
    size2 <- read.delim("../analysis_and_temp_files/02_genome_annotation/SL0000003.lengths.txt") %>% mutate(id="SL0000003")
    size2$X.name <- gsub( " .*$", "", size2$X.name)
    size<-rbind(size2,size1)
    #order contigs
    target <- c("OZ234917.1","OZ234913.1","OZ234906.1","OZ234907.1","OZ234909.1",
                "OZ234908.1","OZ234911.1","OZ234915.1","OZ234912.1","OZ234910.1",
                "OZ234916.1","OZ234914.1","OZ234918.1","OZ234919.1","OZ234921.1",
                "OZ234924.1","OZ234923.1","OZ234922.1","OZ234920.1","OZ234925.1",
                size1$X.name)
    size<-size[match(target, size$X.name),]
    size$X.name <- str_replace(size$X.name,"GTX0536_","")
    size$X.name <- str_replace(size$X.name,"OZ2349","")
    size$X.name <- str_replace(size$X.name,"\\.1","")
    
    write.table(size,"../analysis_and_temp_files/02_genome_annotation/synteny_size.txt",quote = F, col.names = F, row.names = F,sep="\t")
    
    draw.linear.2.0("synteny",
                "../analysis_and_temp_files/02_genome_annotation/synteny_size.txt",
                "../analysis_and_temp_files/02_genome_annotation/synteny_paf.txt",
                h=1.5, w=6 , directory="../results",
                angle.chr.label = 0,chr.label.height = 0.2,insert.size = 600000,
                chr.label.size = 3,sps.label.size = 4)
    ## Saving linear image to ../results

    draw.linear.2.0("synteny",
                "../analysis_and_temp_files/02_genome_annotation/synteny_size.txt",
                "../analysis_and_temp_files/02_genome_annotation/synteny_paf.txt",
                h=1.5, w=6 , directory="../results",fileformat = "pdf",
                angle.chr.label = 0,chr.label.height = 0.2,insert.size = 600000,
                chr.label.size = 3,sps.label.size = 4)
    ## Saving linear image to ../results

    Conclusions so far:

    • Will treat the contigs ptg000001l-ptg000004l and ptg000006l-ptg000020l as the core genome. Several of the contigs required trimming of ends
    • In total, have 20 contigs that have high synteny with a recently published Trebouxia genome from ASG (all but one)
    • Recovered plastid genome as a single contig with 320,516 bp
    • Mitochondria genome will require re-assembly

    2. Nuclear genome annotation

    2.1 Repeat masking

    • First, make a repeat database
    source package 85eb6fb0-3eb7-43b2-9659-49e0142481fc
    BuildDatabase -name analysis_and_temp_files/02_genome_annotation/GTX0536_repeatdb analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort.fasta
    
    RepeatModeler -database analysis_and_temp_files/02_genome_annotation/GTX0536_repeatdb -pa 20 -LTRStruct >& analysis_and_temp_files/02_genome_annotation/GTX0536_repeatmodeler.out
    
    sbatch --mem=100G -c 32 --partition="tsl-long" --wrap="RepeatModeler -database analysis_and_temp_files/02_genome_annotation/GTX0536_repeatdb -pa 20 -LTRStruct >& analysis_and_temp_files/02_genome_annotation/GTX0536_repeatmodeler2.out"
    • Repeat mask
    source package /tsl/software/testing/bin/repeatmasker-4.0.9 
    RepeatMasker -pa 5 -a -s -gff -xsmall -lib analysis_and_temp_files/02_genome_annotation/GTX0536_repeatdb-families.fa analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta &> analysis_and_temp_files/02_genome_annotation/repeatmasker_GTX0536.2.run.out
    file name: GTX0536_nuclear_final_sort2.fasta
    sequences:            20
    total length:   69092103 bp  (69092103 bp excl N/X-runs)
    GC level:         49.68 %
    bases masked:    8791611 bp ( 12.72 %)
    ==================================================
                   number of      length   percentage
                   elements*    occupied  of sequence
    --------------------------------------------------
    SINEs:                0            0 bp    0.00 %
          ALUs            0            0 bp    0.00 %
          MIRs            0            0 bp    0.00 %
    
    LINEs:             4337      1899592 bp    2.75 %
          LINE1        1042       893723 bp    1.29 %
          LINE2           0            0 bp    0.00 %
          L3/CR1          0            0 bp    0.00 %
    
    LTR elements:      1643       984531 bp    1.42 %
          ERVL            0            0 bp    0.00 %
          ERVL-MaLRs      0            0 bp    0.00 %
          ERV_classI     45        44491 bp    0.06 %
          ERV_classII     0            0 bp    0.00 %
    
    DNA elements:       377       391357 bp    0.57 %
         hAT-Charlie      0            0 bp    0.00 %
         TcMar-Tigger     0            0 bp    0.00 %
    
    Unclassified:     15936      3893474 bp    5.64 %
    
    Total interspersed repeats:  7168954 bp   10.38 %
    
    
    Small RNA:          285       219780 bp    0.32 %
    
    Satellites:           0            0 bp    0.00 %
    Simple repeats:   20436      1270597 bp    1.84 %
    Low complexity:    1979       100221 bp    0.15 %

    2.2. Gene prediction

    • GeneMark
    source genemark_ES_ET_EP-4.62_CBG 
    
    mkdir -p analysis_and_temp_files/02_genome_annotation/GTX0536_genemark2
    cd analysis_and_temp_files/02_genome_annotation/GTX0536_genemark2
    gmes_petap.pl --ES --max_intron 3000 --soft_mask 2000 --cores 20 --sequence ../GTX0536_nuclear_final_sort2.fasta.masked
    cd ../../../
    • Funannotate train
    sbatch --mem=120G -c 28 --partition="nbi-long" --wrap="singularity run ../singularity/funannotate.sif funannotate train -i analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta.masked -o analysis_and_temp_files/02_genome_annotation/GTX0536_pred2 --left data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_1.fq.gz --right data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_2.fq.gz --jaccard_clip --cpus 28 --memory 120G --species 'Trebouxia sp. A48'"
    • Funannotate predict
    sbatch --mem=120G -c 28 --partition="nbi-long" --wrap="singularity run ../singularity/funannotate.sif funannotate predict -i analysis_and_temp_files/02_genome_annotation/GTX0536_nuclear_final_sort2.fasta.masked  -o analysis_and_temp_files/02_genome_annotation/GTX0536_pred2 -s 'Trebouxia sp. A48' --cpus 28 --optimize_augustus --genemark_gtf analysis_and_temp_files/02_genome_annotation/GTX0536_genemark2/genemark.gtf --organism other --busco_db chlorophyta_odb10 -d /tsl/scratch/gol22pin/singularity/funannotate2/opt/databases --busco_seed_species chlamydomonas --weights genemark:1"
      Augustus       1        3816
      Augustus HiQ   2        7321
      GeneMark       1        11364
      GlimmerHMM     1        15505
      pasa           6        12814
      snap           1        23161
      Total          -        73981
    [Apr 11 08:51 PM]: 13,273 total gene models from EVM
    [Apr 11 08:51 PM]: Generating protein fasta files from 13,273 EVM models
    [Apr 11 08:51 PM]: now filtering out bad gene models (< 50 aa in length, transposable elements, etc).
    [Apr 11 08:51 PM]: Found 726 gene models to remove: 0 too short; 0 span gaps; 726 transposable elements
    [Apr 11 08:51 PM]: 12,547 gene models remaining
    [Apr 11 08:51 PM]: Predicting tRNAs
    [Apr 11 08:52 PM]: 74 tRNAscan models are valid (non-overlapping)
    [Apr 11 08:52 PM]: Generating GenBank tbl annotation file
    [Apr 11 08:52 PM]: Collecting final annotation files for 12,621 total gene models
    • Funannotate update
    sbatch --mem=120G -c 28 --partition="nbi-long" --wrap="singularity run ../singularity/funannotate.sif funannotate update -i analysis_and_temp_files/02_genome_annotation/GTX0536_pred2 --cpus 28"

    2.3. Functional annotations

    • InterPro
    mkdir -p analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/interpro
    rm -rf temp
    
    #tried newer version InterProScan-5.52-86.0
    #CDD-3.18,Coils-2.2.1,Gene3D-4.3.0,Hamap-2020_05,MobiDBLite-2.0,PANTHER-15.0,Pfam-33.1,PIRSF-3.10,PIRSR-2021_02,PRINTS-42.0,ProSitePatterns-2021_01,ProSiteProfiles-2021_01,SFLD-4,SMART-7.1,SUPERFAMILY-1.75,TIGRFAM-15.0
    
    sbatch --mem=60G -c 20 --partition="tsl-medium" --wrap="source package 0dd71e29-8eb1-4512-b37c-42f7158718f4; source package /tsl/software/testing/bin/gcc-5.2.0; source package 999eb878-6c39-444e-a291-e2e0a86660e6; source package /tsl/software/testing/bin/java-11.0.7; source package 0f2514dd-8288-47ed-96cd-80905f9b0644; source package /tsl/software/production/bin/perl-5.16.2; source package 0dd71e29-8eb1-4512-b37c-42f7158718f4; interproscan.sh -i analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/update_results/Trebouxia_sp._A48.proteins.fa  -d analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/interpro -dp -f XML -goterms -dra -cpu 20"
    • Funannotate annotate
    sbatch --mem=50G -c 20 --partition="tsl-medium" --wrap="singularity run ../singularity/funannotate.sif funannotate annotate -i analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/ --iprscan analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/interpro/Trebouxia_sp._A48.proteins.fa.xml --cpus 20  --sbt analysis_and_temp_files/02_genome_annotation/template.sbt --busco_db /tsl/data/busco_lineages/chlorophyta_odb10  --rename GTX0536PRED"
    [Apr 13 09:29 PM]: Annotation consists of: 12,820 gene models
    [Apr 13 09:29 PM]: 14,492 protein records loaded
    [Apr 13 09:29 PM]: Running HMMer search of PFAM version 35.0
    [Apr 13 09:32 PM]: 14,532 annotations added
    [Apr 13 09:32 PM]: Running Diamond blastp search of UniProt DB version 2023_01
    [Apr 13 09:32 PM]: 535 valid gene/product annotations from 882 total
    [Apr 13 09:32 PM]: Install eggnog-mapper or use webserver to improve functional annotation: https://github.com/jhcepas/eggnog-mapper
    [Apr 13 09:32 PM]: No Eggnog-mapper results found.
    [Apr 13 09:32 PM]: Combining UniProt/EggNog gene and product names using Gene2Product version 1.88
    [Apr 13 09:32 PM]: 535 gene name and product description annotations added
    [Apr 13 09:32 PM]: Running Diamond blastp search of MEROPS version 12.0
    [Apr 13 09:32 PM]: 408 annotations added
    [Apr 13 09:32 PM]: Annotating CAZYmes using HMMer search of dbCAN version 11.0
    [Apr 13 09:33 PM]: 266 annotations added
    [Apr 13 09:33 PM]: Annotating proteins with BUSCO /tsl/data/busco_lineages/chlorophyta_odb10 models
    [Apr 13 09:34 PM]: 1,590 annotations added
    [Apr 13 09:34 PM]: Skipping phobius predictions, try funannotate remote -m phobius
    [Apr 13 09:34 PM]: Skipping secretome: neither SignalP nor Phobius searches were run
    [Apr 13 09:34 PM]: 0 secretome and 0 transmembane annotations added
    [Apr 13 09:35 PM]: Parsing InterProScan5 XML file
    [Apr 13 09:37 PM]: Found 0 duplicated annotations, adding 68,809 valid annotations
    • KEGG annotation via KAAS webserver
      • Used organisms: hsa, mmu, dre, dme, cel, ath, sce, cal, spo, ecu, pfa, cho, ehi, eco, nme, hpy, bsu, lla, mge, mtu, syn, aae, mja, ape, cre, mng, apro, olu, ota, mis, mpp (removed some animals and added all green algae)
    • AntiSMASH. ran both plant anf fungal verision

    2.4. Secretome annotation

    • Ran SignalP

    SignalP

    source package /tsl/software/testing/bin/signalp-5.0b
    signalp -fasta analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -org euk -format short -batch 50000 
    mv Trebouxia_sp._A48.proteins_summary.signalp5 analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/
    • Extracted the list of all 745 proteins with predicted SP and save them as a separate fasta. had to split in two chunks
    library(Biostrings)
    signal<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/Trebouxia_sp._A48.proteins_summary.signalp5",skip=1)
    signal_list<-signal$X..ID[signal$Prediction!="OTHER"]
    
    fa <- readAAStringSet("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.proteins.fa")
    names(fa) <- sub("\\s.*", "",names(fa))
    fa_signal <- fa[names(fa) %in% signal_list]
    writeXStringSet(fa_signal[1:372],"../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.signalp1.fa")
    writeXStringSet(fa_signal[373:745],"../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.signalp2.fa")
    • Fed the new fasta into DeepTMHMM
    • Prepped files to get proteins with/without transmembrane domain and with a signal
    grep "Number of predicted TMRs" analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/TMRs*.gff3 -h > analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/TMR_summary.txt
    
    grep "signal" analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/TMRs*.gff3 -h > analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/deepTMHMM_signal.txt
    • Made the list of 446 proteins. This included all proteins without trans-membrane domains and with a signal (as identified by deepTMHMM) AND proteins predicted by SignalP
    tm<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/TMR_summary.txt",header=F,sep=" ") %>% select(V2,V7)
    colnames(tm)<-c("prot","TM_domains")
    
    tm_signal<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/deepTMHMM_signal.txt",header=F,sep="\t") %>% select(V1,V2)
    colnames(tm_signal)<-c("prot","signal")
    
    tm<-tm %>% left_join(tm_signal)
    ## Joining with `by = join_by(prot)`
    tm_list<-tm$prot[!is.na(tm$signal)&tm$TM_domains==0]
    • Saved the fasta with SingalP+deppTMHMM predictions
    fa_deep <- fa_signal[names(fa_signal) %in% tm_list]
    writeXStringSet(fa_deep,"../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.signalp_deepTMHMM.fa")
    • Ran WolfPSORT
    source package 666e3cc4-643e-4667-9235-fe054b436bfd
    runWolfPsortSummary plant < analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.signalp_deepTMHMM.fa > analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/wolfpsort.out
    • Got 103 proteins with extracellular as the main prediction
    wolf<-read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/wolfpsort.out",skip = 1,header=F)
    colnames(wolf)<-'V1'
    wolf2<-separate(wolf,'V1',into=c('ID','pred'),extra='merge',sep=" ")
    wolf2<- wolf2 %>% filter(grepl("^extr",pred))
    • Saved the fasta and the table
    fa_secreted <- fa_signal[names(fa_signal) %in% wolf2$ID]
    writeXStringSet(fa_secreted,"../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/secretome/Trebouxia_sp._A48.secretome.fa")
    
    ann <- read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/Trebouxia_sp._A48.annotations.reduced.txt") 
    ann_secretome <- ann %>% filter(TranscriptID %in% wolf2$ID)
    
    write.table(ann_secretome,"../results/secretome.txt",quote = F, col.names = T, row.names = F,sep="\t")
    
    library(kableExtra)
    ann_secretome %>% 
      kable(format = "html", col.names = colnames(ann_secretome)) %>%
      kable_styling() %>%
      kableExtra::scroll_box(width = "100%", height = "300px")
    • Which functional domains are overrepresented in the secretome?
    ann <- read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/Trebouxia_sp._A48.annotations.reduced.txt") 
    ann_secretome <- ann %>% filter(TranscriptID %in% wolf2$ID)
    ###make table with GO annotations
    go_df <- ann %>% select(TranscriptID,GO.Terms) %>% 
      mutate(GO.Terms = strsplit(GO.Terms, ";")) %>%
            unnest(GO.Terms) %>%
       mutate(GO.Terms = sub("\\[Evidence\\sIEA\\]", "", GO.Terms)) %>%
      mutate(GO.Terms=sub(".*? ", "", GO.Terms),
             short_term = substr(GO.Terms, 1,40))
    
    go_data <- list(
        term2protein = data.frame(
                            term = go_df$GO.Terms,
                            gene = go_df$TranscriptID
                            ),
        term2name = data.frame(
                            term = go_df$GO.Terms,
                            name = go_df$short_term
                            ),
        
        universe = unique(as.character(go_df$TranscriptID))
    )
    
    
    ###enrichment analysis
    enrich1<-clusterProfiler::enricher(ann_secretome$TranscriptID,
        pAdjustMethod = "none",
        minGSSize = 1,
        maxGSSize = 2000,
        qvalueCutoff = 1,
        universe=go_data$universe,
        TERM2GENE=go_data$term2protein,
        TERM2NAME=go_data$term2name)
    ## 
    pdf(file="../results/secretome_go.pdf",width=6,height=5)
    enrichplot::dotplot(enrich1,showCategory=40,label_format=40)
    dev.off()
    ## quartz_off_screen 
    ##                 2
    enrichplot::dotplot(enrich1,showCategory=40,label_format=40)

    • Same for InterPro
    ips_df <-ann %>% select(TranscriptID,InterPro) %>% 
      mutate(InterPro = strsplit(InterPro, ";")) %>%
            unnest(InterPro)  %>%
      mutate(short_term = substr(InterPro, 1,40))
    
    
    ips_data <- list(
        term2protein = data.frame(
                            term = ips_df$InterPro,
                            gene = ips_df$TranscriptID
                            ),
        term2name = data.frame(
                            term = ips_df$InterPro,
                            name = ips_df$short_term
                            ),
        
        universe = unique(as.character(ips_df$TranscriptID))
    )
    
    
    ###enrichment analysis
    enrich2<-clusterProfiler::enricher(ann_secretome$TranscriptID,
        pAdjustMethod = "none",
        minGSSize = 1,
        maxGSSize = 2000,
        qvalueCutoff = 1,
        universe=ips_data$universe,
        TERM2GENE=ips_data$term2protein,
        TERM2NAME=ips_data$term2name)
    
    enrich2_pairwise<-enrichplot::pairwise_termsim(enrich2)
    pdf(file="../results/secretome_ipr.pdf",width=6,height=5)
    enrichplot::dotplot(enrich2,showCategory=40,label_format=40)
    dev.off()
    ## quartz_off_screen 
    ##                 2
    enrichplot::dotplot(enrich2,showCategory=40,label_format=40)

    • Split by group and visualize
    ann_secretome <- ann_secretome %>% mutate(group = 
          case_when(grepl("GH",CAZyme) | grepl("CE",CAZyme) ~ "Lytic CAZymes",
          Protease != "" ~ "Proteases and inhibitors",
         grepl("IPR013830",InterPro) ~ "Other hydrolases",
         grepl("GT",CAZyme) ~ "Mannosyltransferases",
        grepl("IPR000254",InterPro) | grepl("lectin",InterPro) |
          grepl("xpansin",InterPro) ~ "Carbohydrate-binding",
        grepl("upredoxin",InterPro) | grepl("hioredoxin",InterPro) |
         grepl("superoxide dismutase",InterPro) ~ "Redox proteins",
        grepl("Leucine-rich repeat",InterPro) ~ "LRR proteins",
         grepl( "Ferritin",InterPro) ~ "Ferritin-like",          
           grepl( "IPR000104"  ,InterPro) ~ "Antifreeze protein",      
         InterPro=="" ~ "Uncharacterized"    ))
    ann_secretome$group[is.na(ann_secretome$group)]<-"Other"
    
    ann_secretome$group <- factor(ann_secretome$group,levels=c("Other hydrolases",
       "Proteases and inhibitors", "Lytic CAZymes",
          "Mannosyltransferases",
         "Carbohydrate-binding", "Redox proteins","LRR proteins",
        "Ferritin-like","Antifreeze protein","Other", "Uncharacterized"))
    
    ggplot(ann_secretome,aes(fill=group,x=1))+geom_bar(position="stack")+
       scale_fill_manual(values=c("Other hydrolases" = "#b15928", 
      "Proteases and inhibitors" = "#b2df8a",
      "Lytic CAZymes" = "#1f78b4",
      "Mannosyltransferases" = "#ffff99",
      "Bacteria" = "#6a3d9a",
      "Carbohydrate-binding" = "#fb9a99",
      "Redox proteins"="#33a02c",
      "LRR proteins"="#fdbf6f",
      "Ferritin-like"="#cab2d6",
      "Antifreeze protein"="#a6cee3",
      "Other"="#ff7f00", 
      "Uncharacterized"="#e31a1c"
      ))+
      theme_bw()+xlab("")+
      theme(axis.text.x = element_blank())

    ggsave("../results/secretome_composition.pdf",width=3.5,height=5)
    • What genes are in the OGs that are unique to our genome and to our genome + SL000003 compared to other genomes
    ortho_genes<-read.delim2("../analysis_and_temp_files/03_phylogeny/orthofinder_input/Orthogroups.tsv")
    ann <- read.delim2("../analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/Trebouxia_sp._A48.annotations.reduced.txt")
    
    only_our <- ortho_genes %>% select(Orthogroup,TrebA12_1_GeneCatalog_proteins_20200804.aa,Trebouxia_C0004,
       Trebouxia_C0005,Trebouxia_C0006,Trebouxia_C0009,Trebouxia_C0010,
       Trebouxia_SL0000003_SL0000003.proteins, Trebouxia_sp._A48.proteins) %>%
      filter(Trebouxia_sp._A48.proteins!="",
             TrebA12_1_GeneCatalog_proteins_20200804.aa=="",
             Trebouxia_C0004=="",Trebouxia_C0005=="",
             Trebouxia_C0006=="",Trebouxia_C0009=="",
             Trebouxia_C0010=="",Trebouxia_SL0000003_SL0000003.proteins=="") %>%
      select(Orthogroup,Trebouxia_sp._A48.proteins) %>%
      separate_rows(Trebouxia_sp._A48.proteins,sep=", ") %>%
      mutate(Trebouxia_sp._A48.proteins = str_replace(Trebouxia_sp._A48.proteins,"FUN","GTX0536PRED")) %>%
      left_join(ann,by=c("Trebouxia_sp._A48.proteins"="TranscriptID"))
    
    only_two <- ortho_genes %>% select(Orthogroup,TrebA12_1_GeneCatalog_proteins_20200804.aa,Trebouxia_C0004,
       Trebouxia_C0005,Trebouxia_C0006,Trebouxia_C0009,Trebouxia_C0010,
       Trebouxia_SL0000003_SL0000003.proteins, Trebouxia_sp._A48.proteins) %>%
      filter(Trebouxia_sp._A48.proteins!="",
             TrebA12_1_GeneCatalog_proteins_20200804.aa=="",
             Trebouxia_C0004=="",Trebouxia_C0005=="",
             Trebouxia_C0006=="",Trebouxia_C0009=="",
             Trebouxia_C0010=="",Trebouxia_SL0000003_SL0000003.proteins!="") %>%
      select(Orthogroup,Trebouxia_sp._A48.proteins) %>%
      separate_rows(Trebouxia_sp._A48.proteins,sep=", ") %>%
      mutate(Trebouxia_sp._A48.proteins = str_replace(Trebouxia_sp._A48.proteins,"FUN","GTX0536PRED")) %>%
      left_join(ann,by=c("Trebouxia_sp._A48.proteins"="TranscriptID"))
    
    all <- ortho_genes %>% select(Orthogroup,TrebA12_1_GeneCatalog_proteins_20200804.aa,Trebouxia_C0004,
       Trebouxia_C0005,Trebouxia_C0006,Trebouxia_C0009,Trebouxia_C0010,
       Trebouxia_SL0000003_SL0000003.proteins, Trebouxia_sp._A48.proteins) %>%
      filter(Trebouxia_sp._A48.proteins!="",
             TrebA12_1_GeneCatalog_proteins_20200804.aa!="",
             Trebouxia_C0004!="",Trebouxia_C0005!="",
             Trebouxia_C0006!="",Trebouxia_C0009!="",
             Trebouxia_C0010!="",Trebouxia_SL0000003_SL0000003.proteins!="") %>%
      select(Orthogroup,Trebouxia_sp._A48.proteins) %>%
      separate_rows(Trebouxia_sp._A48.proteins,sep=", ") %>%
      mutate(Trebouxia_sp._A48.proteins = str_replace(Trebouxia_sp._A48.proteins,"FUN","GTX0536PRED")) %>%
      left_join(ann,by=c("Trebouxia_sp._A48.proteins"="TranscriptID"))
    
    ann_secretome %>% filter(TranscriptID %in% only_our$Trebouxia_sp._A48.proteins) %>%
      kable(format = "html", col.names = colnames(ann_secretome)) %>%
      kable_styling() %>%
      kableExtra::scroll_box(width = "100%", height = "300px")
    GeneID TranscriptID Feature Contig Start Stop Strand Name Product Alias.Synonyms EC_number BUSCO PFAM InterPro COG GO.Terms Protease CAZyme group
    GTX0536PRED_001172 GTX0536PRED_001172-T1 mRNA GTX0536_2 71091 73803
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_001172 GTX0536PRED_001172-T2 mRNA GTX0536_2 71091 73803
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_003279 GTX0536PRED_003279-T2 mRNA GTX0536_4 36971 49168
    hypothetical protein NA NA PF13855 IPR001611 Leucine-rich repeat;IPR003591 Leucine-rich repeat, typical subtype;IPR032675 Leucine-rich repeat domain superfamily NA GO_function: GO:0005515 - protein binding [Evidence IEA] LRR proteins
    GTX0536PRED_003929 GTX0536PRED_003929-T1 mRNA GTX0536_4 3381158 3385610
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_003929 GTX0536PRED_003929-T2 mRNA GTX0536_4 3381158 3385610
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_003932 GTX0536PRED_003932-T1 mRNA GTX0536_4 3401151 3405504
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_005581 GTX0536PRED_005581-T1 mRNA GTX0536_6 3458586 3460874
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_007985 GTX0536PRED_007985-T1 mRNA GTX0536_10 1162655 1163900
    hypothetical protein NA NA NA Uncharacterized
    GTX0536PRED_011092 GTX0536PRED_011092-T1 mRNA GTX0536_16 663327 665301
    hypothetical protein NA NA NA Uncharacterized
  • 1 gene in only ours and T SL000003
  • ann_secretome %>% filter(TranscriptID %in% only_two$Trebouxia_sp._A48.proteins) 
    ##               GeneID          TranscriptID Feature    Contig   Start    Stop
    ## 1 GTX0536PRED_001000 GTX0536PRED_001000-T1    mRNA GTX0536_1 5794635 5799786
    ##   Strand Name              Product Alias.Synonyms EC_number BUSCO PFAM InterPro
    ## 1      +      hypothetical protein             NA        NA                    
    ##   COG GO.Terms Protease CAZyme           group
    ## 1  NA                          Uncharacterized
    • 46 genes in all Trebouxias
    ann_secretome %>% filter(TranscriptID %in% all$Trebouxia_sp._A48.proteins) %>% nrow
    ## [1] 46

    3. Plastid genome annotation

    source package aeee87c4-1923-4732-aca2-f2aff23580cc
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536.fasta ptg000005c > analysis_and_temp_files/02_genome_annotation/GTX0536_plastid.fa
    source package /tgac/software/testing/bin/STAR-2.5.4b 
    source package /tgac/software/testing/bin/gcc-4.9.1 
    source package aeee87c4-1923-4732-aca2-f2aff23580cc
    mkdir analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_STAR_index -p
    STAR --runThreadN 10  --genomeSAindexNbases 6 \
    --runMode genomeGenerate \
    --genomeDir analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_STAR_index \
    --genomeFastaFiles analysis_and_temp_files/02_genome_annotation/GTX0536_plastid.fa
    
    sbatch --mem=100G -c 20 --wrap="code/star_align.sh  \
    data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_1.fq.gz \
    data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_2.fq.gz \
    analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_STAR_index/touch 20 analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_GTX0532.bam"
    
    samtools index analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_GTX0532Aligned.sortedByCoord.out.bam
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536_plastid.fa
    source package d6c33ed3-e5cf-4826-b683-023f6b592f0b
    source package 4c883633-af2d-4fac-ab67-a1574f7fe079
    mfannot analysis_and_temp_files/02_genome_annotation/GTX0536_plastid.fa 
    mkdir analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_tmp
    mv GTX0536_plastid.fa* analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_tmp
    
    agat_convert_mfannot2gff.pl -i analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_tmp/GTX0536_plastid.fa.new -o analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_tmp/GTX0536_plastid_mfannot.gff
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/GTX0536_plastid_tmp/job-results-2025328201839/GeSeqJob-20250305-191553_ptg000005c_OGDRAW.jpg")

    4. Mitochondrial genome assembly and annotation

    4.1 Reassemble the mitogenome

    mitocontigs<-df %>% filter(label=="Chlorophyta mitochondrial") %>% 
      mutate(start=1) %>% select(contig,start,Length) 
    write.table(mitocontigs,"../analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.bed",quote = F, col.names = F, row.names = F,sep="\t")
    samtools view -b -L analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.bed analysis_and_temp_files/02_genome_annotation/GTX0536.bam > analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.bam
    
    samtools fastq analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.bam > analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.fastq
    head analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.fastq -n 120000 > analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs_subset.fastq
    gzip analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs_subset.fastq
    
    rm analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.bam
    rm analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs.fastq
    sbatch --mem=100G -c 20 --wrap="source package 3c087633-18b1-4e77-9b08-7e68657fce66; hifiasm -o analysis_and_temp_files/02_genome_annotation/GTX0536_mito_reassembly -t 20 analysis_and_temp_files/02_genome_annotation/GTX0536_mitocontigs_subset.fastq.gz"
    awk '/^S/{print ">"$2;print $3}' analysis_and_temp_files/02_genome_annotation/GTX0536_mito_reassembly.bp.p_ctg.gfa > analysis_and_temp_files/02_genome_annotation/GTX0536_mito_reassembly.fa 
    seqkit fx2tab --length --name --header-line  analysis_and_temp_files/02_genome_annotation/GTX0536_mito_reassembly.fa 
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536_mito_reassembly.fa ptg000001c > analysis_and_temp_files/02_genome_annotation/GTX0536_mito.fa

    4.2. Annotate

    mkdir analysis_and_temp_files/02_genome_annotation/GTX0536_mito_STAR_index -p
    STAR --runThreadN 10  --genomeSAindexNbases 6 \
    --runMode genomeGenerate \
    --genomeDir analysis_and_temp_files/02_genome_annotation/GTX0536_mito_STAR_index \
    --genomeFastaFiles analysis_and_temp_files/02_genome_annotation/GTX0536_mito.fa
    
    sbatch --mem=100G -c 20 --wrap="code/star_align.sh  \
    data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_1.fq.gz \
    data/RNA_seq/X204SC25014007-Z01-F001/01.RawData/GTX0532/GTX0532_EKRN250006470-1A_22MTC7LT4_L8_2.fq.gz \
    analysis_and_temp_files/02_genome_annotation/GTX0536_mito_STAR_index/touch 20 analysis_and_temp_files/02_genome_annotation/GTX0536_mito_GTX0532.bam"
    
    samtools index analysis_and_temp_files/02_genome_annotation/GTX0536_mito_GTX0532Aligned.sortedByCoord.out.bam
    samtools faidx analysis_and_temp_files/02_genome_annotation/GTX0536_mito.fa
    source package d6c33ed3-e5cf-4826-b683-023f6b592f0b
    source package 4c883633-af2d-4fac-ab67-a1574f7fe079
    mfannot analysis_and_temp_files/02_genome_annotation/GTX0536_mito.fa 
    mkdir analysis_and_temp_files/02_genome_annotation/GTX0536_mito_tmp/
    mv GTX0536_mito.fa* analysis_and_temp_files/02_genome_annotation/GTX0536_mito_tmp
    
    agat_convert_mfannot2gff.pl -i analysis_and_temp_files/02_genome_annotation/GTX0536_mito_tmp/GTX0536_mito.fa.new -o analysis_and_temp_files/02_genome_annotation/GTX0536_mito_tmp/GTX0536_mito_mfannot.gff
    knitr::include_graphics("../analysis_and_temp_files/02_genome_annotation/GTX0536_mito_tmp/GTX0536_mito.png")

    5. Nuclear genome of SL0000003

    5.1 Visualize

    • First visualize telomeres and GC% in the same way as above
    python code/detect_telomers.py data/SL0000003.fasta -m "CCCTAAA" > analysis_and_temp_files/02_genome_annotation/SL0000003_telomere_detection.txt
    
    seqkit sliding  data/SL0000003.fasta -s 1000 -W 1000  | seqkit fx2tab -n -g > analysis_and_temp_files/02_genome_annotation/SL0000003.fasta_GC_sliding.txt
    • Here, out of 20 contigs: 3 got both telomeres, 10 got a singe telomere, and 7 got no telomeres
    gc<-read.delim2("../analysis_and_temp_files/02_genome_annotation/SL0000003.fasta_GC_sliding.txt",header=F)[,c(1,2)]
    colnames(gc)<-c("window","gc_content")
    ##get contig name and start of the window
    gc$contig<-sub("_sliding.*", "", gc$window)  
    gc$window<-sub(".*:", "", gc$window)
    gc$window_start<-sub("-.*", "", gc$window) %>% as.numeric()
    gc$gc_content<-gc$gc_content %>% as.numeric()
    
    ##add data for telomere annotation
    tel<-read.delim2("../analysis_and_temp_files/02_genome_annotation/SL0000003_telomere_detection.txt",header=F)[,c(1,2)]
    colnames(tel)<-c("contig","position")
    tel$contig <- gsub( " .*$", "", tel$contig)
    tel_start_contig_list<-tel[tel$position=="forward",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')
    tel_end_contig_list<-tel[tel$position=="reverse",1] #list all contigs that have telomer at the contig start (corresponds to 'forward')
    
    ## get 
    tel_start<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% filter(row_number()<50 & contig %in% tel_start_contig_list) %>% mutate(telomere="present") %>% ungroup()
    
    tel_end<-gc %>% select(contig,window_start) %>% mutate(telomere="absent") %>% group_by(contig) %>% arrange(window_start) %>% 
      dplyr::slice(tail(row_number(), 50)) %>% filter(contig %in% tel_end_contig_list) %>% mutate(telomere="present") %>% ungroup()
    
    gc<-gc %>% left_join(rbind(tel_start,tel_end))
    ## Joining with `by = join_by(contig, window_start)`
    gc$telomere[is.na(gc$telomere)]<-"absent"
    
    ##visualize
    ggplot(gc)+
      geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,color=gc_content,height = 0.8))+
      geom_tile(aes(y=fct_reorder(contig,window_start),x=window_start,alpha=telomere,height=0.8),fill="red")+
      xlab("")+ylab("")+
       scale_alpha_discrete(range=c(0,1))+
      scale_color_viridis(begin = 1,end = 0)+
       scale_x_continuous(breaks = c(0,2000000,4000000,6000000),
                         labels = c("0","2 Mbp","4 Mbp","6 Mbp"))+
      theme_minimal()
    ## Warning: Using alpha for a discrete variable is not advised.

    5.2 Repeat masking

    • First, make a repeat database
    source package 85eb6fb0-3eb7-43b2-9659-49e0142481fc
    BuildDatabase -name analysis_and_temp_files/02_genome_annotation/SL0000003_repeatdb data/SL0000003.fasta
    
    sbatch --mem=40G -c 20 --partition="tsl-long" --wrap="source package 85eb6fb0-3eb7-43b2-9659-49e0142481fc; RepeatModeler -database analysis_and_temp_files/02_genome_annotation/SL0000003_repeatdb -pa 20 -LTRStruct >& analysis_and_temp_files/02_genome_annotation/SL0000003_repeatmodeler.out"
    • Repeat mask
    source package /tsl/software/testing/bin/repeatmasker-4.0.9 
    RepeatMasker -pa 5 -a -s -gff -xsmall -lib analysis_and_temp_files/02_genome_annotation/SL0000003_repeatdb-families.fa data/SL0000003.fasta &> analysis_and_temp_files/02_genome_annotation/repeatmasker_SL0000003.run.out
    ==================================================
    file name: SL0000003.fasta
    sequences:            20
    total length:   63705246 bp  (63687646 bp excl N/X-runs)
    GC level:         50.26 %
    bases masked:    6735955 bp ( 10.57 %)
    ==================================================
                   number of      length   percentage
                   elements*    occupied  of sequence
    --------------------------------------------------
    SINEs:                0            0 bp    0.00 %
          ALUs            0            0 bp    0.00 %
          MIRs            0            0 bp    0.00 %
    
    LINEs:             4003      1395608 bp    2.19 %
          LINE1         644       482141 bp    0.76 %
          LINE2          27         5119 bp    0.01 %
          L3/CR1          0            0 bp    0.00 %
    
    LTR elements:      1229       467903 bp    0.73 %
          ERVL            0            0 bp    0.00 %
          ERVL-MaLRs      0            0 bp    0.00 %
          ERV_classI      0            0 bp    0.00 %
          ERV_classII     0            0 bp    0.00 %
    
    DNA elements:       223       117885 bp    0.19 %
         hAT-Charlie      0            0 bp    0.00 %
         TcMar-Tigger     0            0 bp    0.00 %
    
    Unclassified:     14514      3575967 bp    5.61 %
    
    Total interspersed repeats:  5557363 bp    8.72 %
    
    
    Small RNA:          370       170075 bp    0.27 %
    
    Satellites:           0            0 bp    0.00 %
    Simple repeats:   17880       894185 bp    1.40 %
    Low complexity:    2167       107672 bp    0.17 %
    ==================================================

    5.3. Gene prediction

    • Rename contigs to avoid problems later
    singularity run ../singularity/funannotate.sif funannotate sort -i data/SL0000003.fasta.masked -b scaffold -o data/SL0000003.fasta.masked.renamed
    • GeneMark
    source genemark_ES_ET_EP-4.62_CBG 
    
    mkdir -p analysis_and_temp_files/02_genome_annotation/SL0000003_genemark
    cd analysis_and_temp_files/02_genome_annotation/SL0000003_genemark
    gmes_petap.pl --ES --max_intron 3000 --soft_mask 2000 --cores 20 --sequence ../../../data/SL0000003.fasta.masked.renamed
    cd ../../../
    • Funannotate predict. Since for this genome,we don’t have RNA data, I supplied proteins from GTX0536 as additional protein evidence on top of uniprot
    sbatch --mem=50G -c 20 --partition="tsl-long" --wrap="singularity run ../singularity/funannotate.sif funannotate predict -i data/SL0000003.fasta.masked.renamed -o analysis_and_temp_files/02_genome_annotation/SL0000003_pred --species 'Trebouxia SL0000003' --cpus 20 --strain SL0000003 --optimize_augustus --genemark_gtf analysis_and_temp_files/02_genome_annotation/SL0000003_genemark/genemark.gtf --organism other --busco_db chlorophyta_odb10 -d /tsl/scratch/gol22pin/singularity/funannotate2/opt/databases --busco_seed_species chlamydomonas --weights genemark:1 --protein_evidence ../singularity/funannotate2/opt/databases/uniprot_sprot.fasta analysis_and_temp_files/02_genome_annotation/GTX0536_pred/predict_results/Trebouxia_sp._A48.proteins.fa"
    
    [Apr 07 12:08 PM]: 10,278 total gene models from EVM
    [Apr 07 12:08 PM]: Generating protein fasta files from 10,278 EVM models
    [Apr 07 12:08 PM]: now filtering out bad gene models (< 50 aa in length, transposable elements, etc).
    [Apr 07 12:08 PM]: Found 350 gene models to remove: 3 too short; 0 span gaps; 347 transposable elements
    [Apr 07 12:08 PM]: 9,928 gene models remaining
    [Apr 07 12:08 PM]: Predicting tRNAs
    [Apr 07 12:09 PM]: 133 tRNAscan models are valid (non-overlapping)
    [Apr 07 12:09 PM]: Generating GenBank tbl annotation file
    [Apr 07 12:10 PM]: Collecting final annotation files for 10,061 total gene models

    5.4. Functional annotations

    • InterPro
    source package 0dd71e29-8eb1-4512-b37c-42f7158718f4
    source package /tsl/software/testing/bin/gcc-5.2.0 
    source package 999eb878-6c39-444e-a291-e2e0a86660e6
    source package /tsl/software/testing/bin/java-11.0.7  
    source package 0f2514dd-8288-47ed-96cd-80905f9b0644
    source package /tsl/software/production/bin/perl-5.16.2 
    
    mkdir -p analysis_and_temp_files/02_genome_annotation/SL0000003_pred/interpro
    rm -rf temp
    
    #tried newer version InterProScan-5.52-86.0
    #CDD-3.18,Coils-2.2.1,Gene3D-4.3.0,Hamap-2020_05,MobiDBLite-2.0,PANTHER-15.0,Pfam-33.1,PIRSF-3.10,PIRSR-2021_02,PRINTS-42.0,ProSitePatterns-2021_01,ProSiteProfiles-2021_01,SFLD-4,SMART-7.1,SUPERFAMILY-1.75,TIGRFAM-15.0
    source package 0dd71e29-8eb1-4512-b37c-42f7158718f4 
    interproscan.sh -i analysis_and_temp_files/02_genome_annotation/SL0000003_pred/predict_results/Trebouxia_SL0000003_SL0000003.proteins.fa -d analysis_and_temp_files/02_genome_annotation/SL0000003_pred/interpro -dp -f XML -goterms -dra -cpu 20
    • Funannotate annotate
    singularity run ../singularity/funannotate.sif funannotate annotate -i analysis_and_temp_files/02_genome_annotation/SL0000003_pred/ --iprscan analysis_and_temp_files/02_genome_annotation/SL0000003_pred/interpro/Trebouxia_SL0000003_SL0000003.proteins.fa.xml --cpus 20  --sbt analysis_and_temp_files/02_genome_annotation/template.sbt --busco_db /tsl/data/busco_lineages/chlorophyta_odb10  --rename SL003
    [Apr 08 09:36 AM]: Annotation consists of: 10,061 gene models
    [Apr 08 09:36 AM]: 9,928 protein records loaded
    [Apr 08 09:36 AM]: Running HMMer search of PFAM version 35.0
    [Apr 08 09:38 AM]: 10,572 annotations added
    [Apr 08 09:38 AM]: Running Diamond blastp search of UniProt DB version 2023_01
    [Apr 08 09:39 AM]: 448 valid gene/product annotations from 735 total
    [Apr 08 09:39 AM]: Install eggnog-mapper or use webserver to improve functional annotation: https://github.com/jhcepas/eggnog-mapper
    [Apr 08 09:39 AM]: No Eggnog-mapper results found.
    [Apr 08 09:39 AM]: Combining UniProt/EggNog gene and product names using Gene2Product version 1.88
    [Apr 08 09:39 AM]: 448 gene name and product description annotations added
    [Apr 08 09:39 AM]: Running Diamond blastp search of MEROPS version 12.0
    [Apr 08 09:39 AM]: 332 annotations added
    [Apr 08 09:39 AM]: Annotating CAZYmes using HMMer search of dbCAN version 11.0
    [Apr 08 09:39 AM]: 187 annotations added
    [Apr 08 09:39 AM]: Annotating proteins with BUSCO /tsl/data/busco_lineages/chlorophyta_odb10 models
    [Apr 08 09:41 AM]: 1,281 annotations added
    [Apr 08 09:41 AM]: Skipping phobius predictions, try funannotate remote -m phobius
    [Apr 08 09:41 AM]: Skipping secretome: neither SignalP nor Phobius searches were run
    [Apr 08 09:41 AM]: 0 secretome and 0 transmembane annotations added
    [Apr 08 09:42 AM]: Parsing InterProScan5 XML file
    [Apr 08 09:44 AM]: Found 0 duplicated annotations, adding 51,915 valid annotations

    6. Funannotate compare

    singularity run ../singularity/funannotate.sif funannotate compare -i analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/ analysis_and_temp_files/02_genome_annotation/SL0000003_pred/ -o funannotate_compare --cpus 20 -d /opt/databases
    
    mv funannotate_compare analysis_and_temp_files/02_genome_annotation/

    7. Identifying missing meiosis gene

    blastp -query analysis_and_temp_files/02_genome_annotation/hop1_genbank.fa -subject analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -evalue 1e-5 -outfmt 6
    XP_005651810.1  GTX0536PRED_002087-T1   41.667  180     103     2       24      201     1       180     2.65e-46        165
    blastp -query analysis_and_temp_files/02_genome_annotation/hop2_genbank.fa -subject analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -evalue 1e-5 -outfmt 6
    XP_005643862.1  GTX0536PRED_004154-T1   43.458  214     92      2       4       188     2       215     5.86e-53        167
    blastp -query analysis_and_temp_files/02_genome_annotation/mer3_genbank.fa -subject analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -evalue 1e-5 -outfmt 6
    
    XP_005651102.1  GTX0536PRED_001571-T1   55.401  574     239     3       171     731     1       570     0.0     641
    blastp -query analysis_and_temp_files/02_genome_annotation/mid1_genbank.fa -subject analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -evalue 1e-5 -outfmt 6
    GLI62876.1      GTX0536PRED_009992-T1   48.889  45      23      0       114     158     389     433     8.35e-08        49.7
    GLI62876.1      GTX0536PRED_003745-T1   51.220  41      20      0       119     159     145     185     1.19e-07        48.9
    GLI62876.1      GTX0536PRED_000062-T1   45.000  40      22      0       119     158     322     361     1.86e-06        45.8
    GLI62876.1      GTX0536PRED_005751-T1   43.137  51      26      1       116     163     306     356     6.29e-06        44.3
    GLI62876.1      GTX0536PRED_001901-T1   42.500  40      23      0       119     158     468     507     6.87e-06        44.3
    blastp -query analysis_and_temp_files/02_genome_annotation/fus1_genbank.fa -subject analysis_and_temp_files/02_genome_annotation/GTX0536_pred2/annotate_results/Trebouxia_sp._A48.proteins.fa -evalue 1e-5 -outfmt 6